Snippet Search

Searching 12,404,397 documents.
Discover how a particular term or phrase is used in scientific literature

Showing 1 to 25 of 763479 matching articles

Results per page:

... domain of transmembrane receptors; (2)  protein 
Guanosine Triphosphatases and Their Regulators
Guanosine Triphosphatases and Their Regulators
Thiriet, Marc
synthesis at the ribosome (Vol. 1 – Chap. 5 ...
... because they lack the gene encoding the X  protein 
Viruses with a Double-Stranded DNA Genome
Viruses with a Double-Stranded DNA Genome
Modrow, Susanne; Dietrich, Falke; Truyen, Uwe; Schätzl, Hermann
, a non-structural ...
... Numerous  protein 
Cytoplasmic Protein Serine/Threonine Kinases
Cytoplasmic Protein Serine/Threonine Kinases
Thiriet, Marc
serine/threonine kinases operate in signal ...
... The natural peanut  protein 
Functional Improvement of Peanut Protein Concentrate
Functional Improvement of Peanut Protein Concentrate
Wang, Qiang
has solubility, emulsibility, foamability, ...
... Sequences from the KEGG database of  protein 
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
KEGG orthology-based annotation of the predicted proteome of Acropora digitifera: ZoophyteBase - an open access and searchable database of a coral genome
Dunlap, Walter C; Starcevic, Antonio; Baranasic, Damir; Diminic, Janko; Zucko, Jurica; Gacesa, Ranko; H van Oppen, Madeleine J; Hranueli, Daslav; Cullum, John; Long, Paul F
function were used to construct hidden Markov ...
... Sect. 10.5); (3) some coregulators, such as (  protein 
Other Major Types of Signaling Mediators
Other Major Types of Signaling Mediators
Thiriet, Marc
kinase) A-kinase-anchoring proteins (AKAP; ...
... ABC transporter, periplasmic hemin-binding  protein 
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Growth of Yersinia pseudotuberculosis in human plasma: impacts on virulence and metabolic gene expression
Rosso, Marie-Laure; Chauvaux, Sylvie; Dessein, Rodrigue; Laurans, Caroline; Frangeul, Lionel; Lacroix, Céline; Schiavo, Angèle; Dillies, Marie-Agnès; Foulon, Jeannine; Coppée, Jean-Yves; Médigue, Claudine; Carniel, Elisabeth; Simonet, Michel; Marceau, Michaël
HmuT 1.684 (0.016) 2.149 (0.001) YPTB0339 ...
... abundances of many proteins participating in  protein 
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Comparative proteomic analysis of silkworm fat body after knocking out fibroin heavy chain gene: a novel insight into cross-talk between tissues
Chen, Quanmei; Ma, Zhengang; Wang, Xin; Li, Zhiqing; Zhang, Yan; Ma, Sanyuan; Zhao, Ping; Xia, Qingyou
synthesis, including ribosomal proteins, ...
... Mitogen-activated  protein 
Mitogen-Activated Protein Kinase Module
Mitogen-Activated Protein Kinase Module
Thiriet, Marc
kinase (MAPK) modules are commonly used to ...
...  Protein 
Cytosolic Protein Phosphatases
Cytosolic Protein Phosphatases
Thiriet, Marc
phosphorylation is a common, reversible, ...
... and critical review related to the intake of  protein 
International Society of Sports Nutrition Position Stand: protein and exercise
International Society of Sports Nutrition Position Stand: protein and exercise
Jäger, Ralf; Kerksick, Chad M.; Campbell, Bill I.; Cribb, Paul J.; Wells, Shawn D.; Skwiat, Tim M.; Purpura, Martin; Ziegenfuss, Tim N.; Ferrando, Arny A.; Arent, Shawn M.; Smith-Ryan, Abbie E.; Stout, Jeffrey R.; Arciero, Paul J.; Ormsbee, Michael J.; Taylor, Lem W.; Wilborn, Colin D.; Kalman, Doug S.; Kreider, Richard B.; Willoughby, Darryn S.; Hoffman, Jay R.; Krzykowski, Jamie L.; Antonio, Jose
for healthy, exercising individuals. ...
... food researchers to explore alternative  protein 
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Protein Modification During Ingredient Preparation and Food Processing: Approaches to Improve Food Processability and Nutrition
Sun-Waterhouse, Dongxiao; Zhao, Mouming; Waterhouse, Geoffrey I. N.
sources and sustainable and optimized use of ...
... contain large quantities of the precursor  protein 
Viruses with Single-Stranded, Positive-Sense RNA Genomes
Viruses with Single-Stranded, Positive-Sense RNA Genomes
Modrow, Susanne; Falke, Dietrich; Truyen, Uwe; Schätzl, Hermann
. ...
... an explosion of research papers concerning  protein 
Contemporary Issues in Protein Requirements and Consumption for Resistance Trained Athletes
Contemporary Issues in Protein Requirements and Consumption for Resistance Trained Athletes
Wilson, Jacob; Wilson, Gabriel J
consumption has been published. ...
... changes in lipid (Uemura et al. 1995) and  protein 
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays
Oono, Youko; Seki, Motoaki; Satou, Masakazu; Iida, Kei; Akiyama, Kenji; Sakurai, Tetsuya; Fujita, Miki; Yamaguchi-Shinozaki, Kazuko; Shinozaki, Kazuo
(Kawamura and Uemura 2003) composition of ...
... tumor suppressor gene found – The encoded  protein 
Cancer Genetics at a Glance: The Comprehensive Insights
Cancer Genetics at a Glance: The Comprehensive Insights
Azarnezhad, Asaad; Mehdipour, Parvin
also stabilizes constitutive heterochromatin ...
... F3 Extracellular solute-binding  protein 
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Early gene expression in Pseudomonas fluorescens exposed to a polymetallic solution
Gómez-Sagasti, María T.; Becerril, José M.; Epelde, Lur; Alkorta, Itziar; Garbisu, Carlos
3 F: CGCTTGCAGTACCAGATCCC R: ...
... Multiparameter Proteomics Using  Protein 
Personalized Diagnosis and Therapy
Personalized Diagnosis and Therapy
Müller, Günter
Chips Purpose and Rationale Patient-tailored ...
... solubilization processes for isolating muscle  protein 
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
The Acid and Alkaline Solubilization Process for the Isolation of Muscle Proteins: State of the Art
Nolsøe, Helgi; Undeland, Ingrid
from ground fish raw materials are ...
... transducing adapter molecule 1 ribosomal  protein 
Unscrambling butterfly oogenesis
Unscrambling butterfly oogenesis
Carter, Jean-Michel; Baker, Simon C; Pink, Ryan; Carter, David RF; Collins, Aiden; Tomlin, Jeremie; Gibbs, Melanie; Breuker, Casper J
LP2 PACG20471 nucleolar GTP-binding ...
... attaining and maintaining muscle mass. From  protein 
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Building Muscle Mass: Physiology, Nutrition, and Supplementation
Levers, Kyle; Vargo, Kelley
to creatine, arginine to human growth ...
... system, the classic isoforms of myelin basic  protein 
Turning White Matter “Inside-Out” by Hyper-deimination of Myelin Basic Protein (MBP)
Turning White Matter “Inside-Out” by Hyper-deimination of Myelin Basic Protein (MBP)
Harauz, George
(MBP) are essential to the development and ...
... transcripts by interfering with any RNA–  protein 
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
The effect of temperature on Natural Antisense Transcript (NAT) expression in Aspergillus flavus
Smith, Carrie A.; Robertson, Dominique; Yates, Bethan; Nielsen, Dahlia M.; Brown, Doug; Dean, Ralph A.; Payne, Gary A.
interactions, including mRNA splicing ...
... Multiparameter Proteomics Using  Protein 
Personalized Diagnosis and Therapy
Personalized Diagnosis and Therapy
Müller, Günter
Chips Purpose and Rationale Patient-tailored ...
... TNS order HNS order 1 JHP0952 hypothetical  protein 
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Inter-species horizontal transfer resulting in core-genome and niche-adaptive variation within Helicobacter pylori
Saunders, Nigel J; Boonmee, Prawit; Peden, John F; Jarvis, Stephen A
HP0427 14 3 1355 2 JHP0476 cag pathogenicity ...